pLV-PGK-DIO-mCherry-nega miR
(Plasmid
#137732)
-
PurposeLentivirus vector for control miR in a Cre-dependent manner
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 137732 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLV-PGK-GFP
-
Backbone manufacturerÅkerblom et al., 2013
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecontrol microRNA
-
gRNA/shRNA sequenceTGC TGA AAT GTA CTG CGC GTG GAG ACG TTT TGG CCA CTG ACT GAC GTC TCC ACG CAG TAC ATT T
-
SpeciesM. musculus (mouse)
-
Tag
/ Fusion Protein
- mChherry (N terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer tgacaacgggccacaactcc
- 3′ sequencing primer CCCTCGTTGACCGAATCACC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThermo Fisher Scientific
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
the website for the BLOCK-iT RNAi Designer
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV-PGK-DIO-mCherry-nega miR was a gift from Tomoyuki Furuyashiki (Addgene plasmid # 137732 ; http://n2t.net/addgene:137732 ; RRID:Addgene_137732) -
For your References section:
The Innate Immune Receptors TLR2/4 Mediate Repeated Social Defeat Stress-Induced Social Avoidance through Prefrontal Microglial Activation. Nie X, Kitaoka S, Tanaka K, Segi-Nishida E, Imoto Y, Ogawa A, Nakano F, Tomohiro A, Nakayama K, Taniguchi M, Mimori-Kiyosue Y, Kakizuka A, Narumiya S, Furuyashiki T. Neuron. 2018 Aug 8;99(3):464-479.e7. doi: 10.1016/j.neuron.2018.06.035. Epub 2018 Jul 19. 10.1016/j.neuron.2018.06.035 PubMed 30033154