Skip to main content

pPN434
(Plasmid #137866)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 137866 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pX330S-2
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TCF4
  • gRNA/shRNA sequence
    CATCACCATGGACTCCCCCG
  • Species
    H. sapiens (human)
  • Entrez Gene
    TCF4 (a.k.a. CDG2T, E2-2, FCD2, FECD3, ITF-2, ITF2, PTHS, SEF-2, SEF2, SEF2-1, SEF2-1A, SEF2-1B, SEF2-1D, TCF-4, bHLHb19)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPN434 was a gift from Lindy Barrett (Addgene plasmid # 137866 ; http://n2t.net/addgene:137866 ; RRID:Addgene_137866)
  • For your References section:

    A multiplexed gRNA piggyBac transposon system facilitates efficient induction of CRISPRi and CRISPRa in human pluripotent stem cells. Hazelbaker DZ, Beccard A, Angelini G, Mazzucato P, Messana A, Lam D, Eggan K, Barrett LE. Sci Rep. 2020 Jan 20;10(1):635. doi: 10.1038/s41598-020-57500-1. 10.1038/s41598-020-57500-1 PubMed 31959800