Skip to main content
Addgene

pMDC32B-AtTAS1c-D2-B/c
(Plasmid #137884)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 137884 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pMDC32
  • Backbone manufacturer
    Thermo Fisher Scientific
  • Backbone size w/o insert (bp) 10141
  • Total vector size (bp) 12592
  • Vector type
    Plant Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Kanamycin, 25 & 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    AtTAS1c-D2-B/c
  • Species
    A. thaliana (mustard weed)
  • Insert Size (bp)
    2451
  • Mutation
    A. thaliana TAS1c precursor sequence including a chloramphenicol-ccdB cassette flanked by two inverted BsaI sites downstream the 3'D1[+] position. The BsaI site in the ccdB gene was mutated to block the site.
  • Promoter 2x35S

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer RC-attB1: ACAAGTTTGTACAAAAAAGCAGGCT
  • 3′ sequencing primer RC-attB2: ACCACTTTGTACAAGAAAGCTGGGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMDC32B-AtTAS1c-D2-B/c was a gift from Alberto Carbonell (Addgene plasmid # 137884 ; http://n2t.net/addgene:137884 ; RRID:Addgene_137884)
  • For your References section:

    Fine-tune control of targeted RNAi efficacy by plant artificial small RNAs. Lopez-Dolz L, Spada M, Daros JA, Carbonell A. Nucleic Acids Res. 2020 May 12. pii: 5836195. doi: 10.1093/nar/gkaa343. 10.1093/nar/gkaa343 PubMed 32396204