Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

(Plasmid #137884)


Item Catalog # Description Quantity Price (USD)
Plasmid 137884 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Thermo Fisher Scientific
  • Backbone size w/o insert (bp) 10141
  • Total vector size (bp) 12592
  • Vector type
    Plant Expression
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Kanamycin, 25 & 50 μg/mL
  • Growth Temperature
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    Low Copy


  • Gene/Insert name
  • Species
    A. thaliana (mustard weed)
  • Insert Size (bp)
  • Mutation
    A. thaliana TAS1c precursor sequence including a chloramphenicol-ccdB cassette flanked by two inverted BsaI sites downstream the 3'D1[+] position. The BsaI site in the ccdB gene was mutated to block the site.
  • Promoter 2x35S

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer RC-attB1: ACAAGTTTGTACAAAAAAGCAGGCT
  • 3′ sequencing primer RC-attB2: ACCACTTTGTACAAGAAAGCTGGGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMDC32B-AtTAS1c-D2-B/c was a gift from Alberto Carbonell (Addgene plasmid # 137884 ; ; RRID:Addgene_137884)
  • For your References section:

    Fine-tune control of targeted RNAi efficacy by plant artificial small RNAs. Lopez-Dolz L, Spada M, Daros JA, Carbonell A. Nucleic Acids Res. 2020 May 12. pii: 5836195. doi: 10.1093/nar/gkaa343. 10.1093/nar/gkaa343 PubMed 32396204