pMDC32B-AtTAS1c-D2-B/c-AtMIR173
(Plasmid
#137885)
-
PurposePlant expression vector for direct cloning of synthetic trans-acting siRNAs into Arabidopsis thaliana TAS1c precursor downstream 3'D1[+]. Contains AtMIR173 for syntasi expression in any plant species.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 137885 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMDC32
-
Backbone manufacturerThermo Fisher Scientific
- Backbone size w/o insert (bp) 10141
- Total vector size (bp) 14339
-
Vector typePlant Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Kanamycin, 25 & 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameAtTAS1c-D2-B/c
-
SpeciesA. thaliana (mustard weed)
-
Insert Size (bp)2451
-
MutationA. thaliana TAS1c precursor sequence including a chloramphenicol-ccdB cassette flanked by two inverted BsaI sites downstream the 3'D1[+] position. The BsaI site in the ccdB gene was mutated to block the site.
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer AAACCTAAACCTAAACGGCTAAGC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert name2x35S-AtMIR173-Tnos
-
SpeciesA. thaliana (mustard weed)
-
Insert Size (bp)1747
-
MutationAtMIR173 sequence with two nucleotide substitutions to block natural BsaI sites, flanked by the 2x35S promoter and Tnos terminator sequences
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer caccATAATTAGCAAGTAATAAGG
- 3′ sequencing primer ATCTGTTATACAACCAAATCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMDC32B-AtTAS1c-D2-B/c-AtMIR173 was a gift from Alberto Carbonell (Addgene plasmid # 137885 ; http://n2t.net/addgene:137885 ; RRID:Addgene_137885) -
For your References section:
Fine-tune control of targeted RNAi efficacy by plant artificial small RNAs. Lopez-Dolz L, Spada M, Daros JA, Carbonell A. Nucleic Acids Res. 2020 May 12. pii: 5836195. doi: 10.1093/nar/gkaa343. 10.1093/nar/gkaa343 PubMed 32396204