Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
As of April 1, 2023, we increased some of our prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pMDC32B-AtTAS1c-D2-B/c-AtMIR173
(Plasmid #137885)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 137885 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMDC32
  • Backbone manufacturer
    Thermo Fisher Scientific
  • Backbone size w/o insert (bp) 10141
  • Total vector size (bp) 14339
  • Vector type
    Plant Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Kanamycin, 25 & 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    AtTAS1c-D2-B/c
  • Species
    A. thaliana (mustard weed)
  • Insert Size (bp)
    2451
  • Mutation
    A. thaliana TAS1c precursor sequence including a chloramphenicol-ccdB cassette flanked by two inverted BsaI sites downstream the 3'D1[+] position. The BsaI site in the ccdB gene was mutated to block the site.

Cloning Information for Gene/Insert 1

Gene/Insert 2

  • Gene/Insert name
    2x35S-AtMIR173-Tnos
  • Species
    A. thaliana (mustard weed)
  • Insert Size (bp)
    1747
  • Mutation
    AtMIR173 sequence with two nucleotide substitutions to block natural BsaI sites, flanked by the 2x35S promoter and Tnos terminator sequences

Cloning Information for Gene/Insert 2

  • Cloning method Unknown
  • 5′ sequencing primer caccATAATTAGCAAGTAATAAGG
  • 3′ sequencing primer ATCTGTTATACAACCAAATCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMDC32B-AtTAS1c-D2-B/c-AtMIR173 was a gift from Alberto Carbonell (Addgene plasmid # 137885 ; http://n2t.net/addgene:137885 ; RRID:Addgene_137885)
  • For your References section:

    Fine-tune control of targeted RNAi efficacy by plant artificial small RNAs. Lopez-Dolz L, Spada M, Daros JA, Carbonell A. Nucleic Acids Res. 2020 May 12. pii: 5836195. doi: 10.1093/nar/gkaa343. 10.1093/nar/gkaa343 PubMed 32396204