Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pFP.R365
(Plasmid #138235)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 138235 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSB3T5
  • Backbone manufacturer
    BioBrick vector, IGEM registry
  • Backbone size w/o insert (bp) 3252
  • Total vector size (bp) 5695
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Tetracycline, 10 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    araC
  • Insert Size (bp)
    930
  • Entrez Gene
    araC (a.k.a. b0064, ECK0065)
  • Promoter iPC

Cloning Information for Gene/Insert 1

Gene/Insert 2

  • Gene/Insert name
    mCherryN(HGK).EP-Pri*.(TEV)mCherryC.H6
  • Species
    Synthetic
  • Insert Size (bp)
    1221
  • Promoter P(araBAD)
  • Tag / Fusion Protein
    • 6xHis (C terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer araC_F2 - AACCCACTGGTGATACCATTCG
  • 3′ sequencing primer VR - ATTACCGCCTTTGAGTGAGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFP.R365 was a gift from Baojun Wang (Addgene plasmid # 138235 ; http://n2t.net/addgene:138235 ; RRID:Addgene_138235)
  • For your References section:

    An expanded library of orthogonal split inteins enables modular multi-peptide assemblies. Pinto F, Thornton EL, Wang B. Nat Commun. 2020 Mar 23;11(1):1529. doi: 10.1038/s41467-020-15272-2. 10.1038/s41467-020-15272-2 PubMed 32251274