pFP.R368
(Plasmid
#138238)
-
PurposeExpresses the split mCherry reporter interrupted by the MP-B-DnaB artificially mini-intein (in cis)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 138238 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSB3T5
-
Backbone manufacturerBioBrick vector, IGEM registry
- Backbone size w/o insert (bp) 3252
- Total vector size (bp) 5701
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Tetracycline, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert namearaC
-
Insert Size (bp)930
-
Entrez GenearaC (a.k.a. b0064, ECK0065)
- Promoter iPC
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer VF2 - TGCCACCTGACGTCTAAGAA
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namemCherryN(QDQ).MP-B-DnaB*.(TKN)mCherryC.H6
-
SpeciesSynthetic
-
Insert Size (bp)1227
- Promoter P(araBAD)
-
Tag
/ Fusion Protein
- 6xHis (C terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer araC_F2 - AACCCACTGGTGATACCATTCG
- 3′ sequencing primer VR - ATTACCGCCTTTGAGTGAGC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFP.R368 was a gift from Baojun Wang (Addgene plasmid # 138238 ; http://n2t.net/addgene:138238 ; RRID:Addgene_138238) -
For your References section:
An expanded library of orthogonal split inteins enables modular multi-peptide assemblies. Pinto F, Thornton EL, Wang B. Nat Commun. 2020 Mar 23;11(1):1529. doi: 10.1038/s41467-020-15272-2. 10.1038/s41467-020-15272-2 PubMed 32251274