scAAV-hSyn-Cre
(Plasmid
#138253)
-
PurposeA self-complementary AAV vector expresses Cre recombinase from hSyn promoter.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 138253 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonescAAV
- Backbone size w/o insert (bp) 4000
- Total vector size (bp) 6500
-
Vector typeMammalian Expression, AAV, Cre/Lox
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCre recombinase
-
Alt nameCre
-
SpeciesSynthetic
-
Insert Size (bp)2064
-
GenBank ID2777477
- Promoter hSyn
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer ATGTCCAATTTACTGACCGTACAC
- 3′ sequencing primer CTAATCGCCATCTTCCAGC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byWe purchase the whole vector from a cloning service company.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
scAAV-hSyn-Cre was a gift from Li Zhang (Addgene plasmid # 138253 ; http://n2t.net/addgene:138253 ; RRID:Addgene_138253) -
For your References section:
Synaptic Specificity and Application of Anterograde Transsynaptic AAV for Probing Neural Circuitry. Zingg B, Peng B, Huang J, Tao HW, Zhang LI. J Neurosci. 2020 Apr 15;40(16):3250-3267. doi: 10.1523/JNEUROSCI.2158-19.2020. Epub 2020 Mar 20. 10.1523/JNEUROSCI.2158-19.2020 PubMed 32198185