-
PurposeExpress EBFP with an upstream T7 promoter in a lentiviral backbone
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 138615 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLX
- Total vector size (bp) 9485
-
Vector typeLentiviral
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameEBFP
-
Insert Size (bp)720
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TTCAGGTGTCGTGAGGCTA
- 3′ sequencing primer TCCAGAGGTTGATTGTCGAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLX - T7pro - EBFP was a gift from Fei Chen (Addgene plasmid # 138615 ; http://n2t.net/addgene:138615 ; RRID:Addgene_138615) -
For your References section:
Efficient, continuous mutagenesis in human cells using a pseudo-random DNA editor. Chen H, Liu S, Padula S, Lesman D, Griswold K, Lin A, Zhao T, Marshall JL, Chen F. Nat Biotechnol. 2019 Dec 16. pii: 10.1038/s41587-019-0331-8. doi: 10.1038/s41587-019-0331-8. 10.1038/s41587-019-0331-8 PubMed 31844291