pAMS366-4xCDRE-GFP-PEST
(Plasmid
#138658)
-
Purposedestabilized GFP reporter to monitor calcineurin activity via calcineurin-dependent response element (CDRE) in S. cerevisiae
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 138658 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepAMS366
- Total vector size (bp) 11281
-
Vector typeyeast reporter plasmid
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert name4xCDRE-CYC1(PM)-yEGFP3-PEST
-
SpeciesS. cerevisiae (budding yeast), Synthetic; A. victoria
- Promoter CYC1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer GTG GGT TTA GAT GAC AAG GGA GAC G and CAC AAA TTT TCT GTC TCC G and GTC TTG TTA CCA GAC AAC C (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made by1. Stathopoulos AM, and Cyert MS (1997). Calcineurin acts through the CRZ1/TCN1-encoded transcription factor to regulate gene expression in yeast. Genes Dev. 11(24): 3432–3444. 9407035. and 2. Mateus C, and Avery SV (2000). Destabilized green fluorescent protein for monitoring dynamic changes in yeast gene expression with flow cytometry. Yeast. 16(14): 1313–1323. doi: 10.1002/1097-0061(200010)16:14<1313::AID-YEA626>3.0.CO;2-O.
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
1x CDRE (calcineurin-dependent response element) = caagcgcacagccaccgactggtg
For construction of pAMS366-4xCDRE-GFP-PEST, we used yEGFP3-PEST from
Mateus & Avery 2000 (original yEGFP3 from Cormack et al. 1997),
sequencing showed a 216T>G silent mutation.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAMS366-4xCDRE-GFP-PEST was a gift from Sabrina Büttner (Addgene plasmid # 138658 ; http://n2t.net/addgene:138658 ; RRID:Addgene_138658) -
For your References section:
Stable and destabilized GFP reporters to monitor calcineurin activity in Saccharomyces cerevisiae. Diessl , J., Nandy, A., Schug, C., Habernig, L., and Büttner, S.. Microbial Cell, 2020: in press