Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pLenti-Puro-sgBRSK2
(Plasmid #138687)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 138687 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgBRSK2 human
  • gRNA/shRNA sequence
    ATCTCAATGGCCCGCCGCGC
  • Species
    H. sapiens (human)
  • Entrez Gene
    BRSK2 (a.k.a. C11orf7, PEN11B, SAD1, SADA, STK29)
  • Promoter hU6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-Puro-sgBRSK2 was a gift from Reuben Shaw (Addgene plasmid # 138687 ; http://n2t.net/addgene:138687 ; RRID:Addgene_138687)
  • For your References section:

    The AMPK-Related Kinases SIK1 and SIK3 Mediate Key Tumor-Suppressive Effects of LKB1 in NSCLC. Hollstein PE, Eichner LJ, Brun SN, Kamireddy A, Svensson RU, Vera LI, Ross DS, Rymoff TJ, Hutchins A, Galvez HM, Williams AE, Shokhirev MN, Screaton RA, Berdeaux R, Shaw RJ. Cancer Discov. 2019 Nov;9(11):1606-1627. doi: 10.1158/2159-8290.CD-18-1261. Epub 2019 Jul 26. 10.1158/2159-8290.CD-18-1261 PubMed 31350328