Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pShuttle-CMV-EGFP-CA
(Plasmid #13886)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 13886 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pShuttle-CMV
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 7500
  • Vector type
    Adenoviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    CA domains of N-WASP
  • Alt name
    EGFP-CA
  • Alt name
    WASL
  • Species
    B. taurus (bovine)
  • Insert Size (bp)
    859
  • GenBank ID
    NM_174219
  • Entrez Gene
    WASL (a.k.a. BOS_4408)
  • Tag / Fusion Protein
    • EGFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site HinDIII (not destroyed)
  • 5′ sequencing primer GGCACCAAAATCAACGGGACTTTCC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The original full length N-WASP gene clone was given to me by Dr. Laura Machesky School of Biosciences The University of Birmingham Edgbaston Birmingham B15 2TT UK [email protected]

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pShuttle-CMV-EGFP-CA was a gift from Lorene Lanier (Addgene plasmid # 13886 ; http://n2t.net/addgene:13886 ; RRID:Addgene_13886)
  • For your References section:

    Arp2/3 is a negative regulator of growth cone translocation. Strasser GA, Rahim NA, VanderWaal KE, Gertler FB, Lanier LM. Neuron. 2004 Jul 8. 43(1):81-94. 10.1016/j.neuron.2004.05.015 PubMed 15233919