pShuttle-CMV-EGFP-C
(Plasmid
#13887)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 13887 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepShuttle-CMV
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 7500
-
Vector typeAdenoviral
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameC domain of N-WASP
-
Alt nameEGFP-C
-
Alt nameWASL
-
SpeciesB. taurus (bovine)
-
Insert Size (bp)789
-
MutationThe BglII site in the MCS of pShuttle-CMV was filled and the vector was religated in order to remove this BglII site.
-
GenBank IDNM_174219
-
Entrez GeneWASL (a.k.a. BOS_4408)
-
Tag
/ Fusion Protein
- EGFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site HinDIII (not destroyed)
- 5′ sequencing primer GGCACCAAAATCAACGGGACTTTCC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe original full length N-WASP gene clone was given to me by Dr. Laura Machesky School of Biosciences The University of Birmingham Edgbaston Birmingham B15 2TT UK [email protected]
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pShuttle-CMV-EGFP-C was a gift from Lorene Lanier (Addgene plasmid # 13887 ; http://n2t.net/addgene:13887 ; RRID:Addgene_13887) -
For your References section:
Arp2/3 is a negative regulator of growth cone translocation. Strasser GA, Rahim NA, VanderWaal KE, Gertler FB, Lanier LM. Neuron. 2004 Jul 8. 43(1):81-94. 10.1016/j.neuron.2004.05.015 PubMed 15233919