-
PurposePeft-3::wrmScarlet1-10::unc-54 3’UTR. Expresses wrmScarlet1-10 in somatic tissues of C. elegans
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 138966 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC57
- Backbone size w/o insert (bp) 2626
- Total vector size (bp) 4730
-
Vector typeWorm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namewrmScarlet1-10
-
SpeciesC. elegans (nematode)
-
Insert Size (bp)780
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer ATGGTATCGAAGGGAGAAGC
- 3′ sequencing primer TTAGTACTCGTTGTGGGAGGTG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2020.07.02.185249v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJG100 was a gift from Cynthia Kenyon (Addgene plasmid # 138966 ; http://n2t.net/addgene:138966 ; RRID:Addgene_138966) -
For your References section:
Split-wrmScarlet and split-sfGFP: tools for faster, easier fluorescent labeling of endogenous proteins in Caenorhabditis elegans. Goudeau J, Sharp CS, Paw J, Savy L, Leonetti MD, York AG, Updike DL, Kenyon C, Ingaramo M. Genetics. 2021 Apr 15;217(4). pii: 6126424. doi: 10.1093/genetics/iyab014. 10.1093/genetics/iyab014 PubMed 33693628