pMSCV-NLS-CBGreen-FIRE-puro
(Plasmid
#139195)
-
PurposeLuminescent reporter of ERK activity
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 139195 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMSCV-puro
- Backbone size w/o insert (bp) 6261
- Total vector size (bp) 8278
-
Vector typeMammalian Expression, Retroviral, Luciferase
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCBG99
-
Alt nameClick beetle green luciferase
-
SpeciesSynthetic; Pyrophosphorus plagiophthalamus
-
MutationSee depositor comments below
-
Tags
/ Fusion Proteins
- nuclear localization signal (NLS) (N terminal on insert)
- Fra1 PEST domain fragment (FIRE) (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CCCTTGAACCTCCTCGTTCGACC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note: This plasmid contains a G255V mutation in CBG99. This mutation is not expected to affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMSCV-NLS-CBGreen-FIRE-puro was a gift from Matthew Lazzara (Addgene plasmid # 139195 ; http://n2t.net/addgene:139195 ; RRID:Addgene_139195) -
For your References section:
Glioblastoma Cell Resistance to EGFR and MET Inhibition Can Be Overcome via Blockade of FGFR-SPRY2 Bypass Signaling. Day EK, Sosale NG, Xiao A, Zhong Q, Purow B, Lazzara MJ. Cell Rep. 2020 Mar 10;30(10):3383-3396.e7. doi: 10.1016/j.celrep.2020.02.014. 10.1016/j.celrep.2020.02.014 PubMed 32160544