Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pEGFP - FLAG-APEX2- hs Lamin B1
(Plasmid #139442)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 139442 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    Alice Ting (Addgene plasmid # 66171
  • Backbone size w/o insert (bp) 4026
  • Total vector size (bp) 6582
  • Modifications to backbone
    This backbone comes from Addgene #66171
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    LMNB1
  • Alt name
    Lamin B1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1761
  • Entrez Gene
    LMNB1 (a.k.a. ADLD, LMN, LMN2, LMNB, MCPH26)
  • Promoter CMV
  • Tags / Fusion Proteins
    • FLAG (N terminal on backbone)
    • APEX2
    • 3xGGGGS linker (between APEX2 and Lamin B1)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer GACCTCGGGCTCGGGCTCC
  • 3′ sequencing primer CCTCAGCCACTGGAAATGTT
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

The parent backbone is from Alice Ting (Addgene plasmid # 66171; Lam et al Nat Methods. 2014 Nov 24. doi: 10.1038/nmeth.3179). This backbone was digested with BamHI and XhoI. The human Lmnb1 cDNA was amplified with a 5' primer containing the XhoI site and a 3x GGGGS linker. The 3' primer contained the BamHI site.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP - FLAG-APEX2- hs Lamin B1 was a gift from Yixian Zheng (Addgene plasmid # 139442 ; http://n2t.net/addgene:139442 ; RRID:Addgene_139442)