-
PurposeAPEX2-Lamin B1 expression plasmid
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 139442 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneAlice Ting (Addgene plasmid # 66171
- Backbone size w/o insert (bp) 4026
- Total vector size (bp) 6582
-
Modifications to backboneThis backbone comes from Addgene #66171
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameLMNB1
-
Alt nameLamin B1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1761
-
Entrez GeneLMNB1 (a.k.a. ADLD, LMN, LMN2, LMNB, MCPH26)
- Promoter CMV
-
Tags
/ Fusion Proteins
- FLAG (N terminal on backbone)
- APEX2
- 3xGGGGS linker (between APEX2 and Lamin B1)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer GACCTCGGGCTCGGGCTCC
- 3′ sequencing primer CCTCAGCCACTGGAAATGTT
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The parent backbone is from Alice Ting (Addgene plasmid # 66171; Lam et al Nat Methods. 2014 Nov 24. doi: 10.1038/nmeth.3179). This backbone was digested with BamHI and XhoI. The human Lmnb1 cDNA was amplified with a 5' primer containing the XhoI site and a 3x GGGGS linker. The 3' primer contained the BamHI site.
Please visit https://www.biorxiv.org/content/10.1101/2020.02.05.935635v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP - FLAG-APEX2- hs Lamin B1 was a gift from Yixian Zheng (Addgene plasmid # 139442 ; http://n2t.net/addgene:139442 ; RRID:Addgene_139442) -
For your References section:
The versatility of Ascorbate Peroxidase-aided mapping uncovers insights of the nuclear lamina interactions and function. Tran JR, Paulson DI, Moresco JJ, Adam SA, Yates JR, Goldman RD, Zheng Y. bioRxiv 2020.02.05.935635 10.1101/2020.02.05.935635