Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pNTI647 dCas9-Mxi1 TetR KanMX
(Plasmid #139474)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 139474 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCfB2225
  • Backbone manufacturer
    Irina Borodina (Addgene plasmid # 67553)
  • Backbone size w/o insert (bp) 6144
  • Total vector size (bp) 12654
  • Vector type
    Yeast Expression, CRISPR
  • Selectable markers
    KanMX

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    dCas9-Mxi1
  • Species
    Synthetic; S pyogenes Cas9
  • Insert Size (bp)
    4344
  • Mutation
    D10A, H840A
  • Promoter pTEF1
  • Tags / Fusion Proteins
    • NLS (N terminal on insert)
    • NLS (C terminal on insert)
    • Mxi1 (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CTCTTTCGATGACCTCCCATTG
  • 3′ sequencing primer gtaatacgactcactataggg
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Tet Repressor
  • Alt name
    TetR
  • Species
    Bacterial
  • Insert Size (bp)
    624
  • Promoter pGPM1

Cloning Information for Gene/Insert 2

  • Cloning method Gateway Cloning
  • 5′ sequencing primer gagtacaaacgcatgaaatcc
  • 3′ sequencing primer CGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    AddGene plasmids #73796 and #67553
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pNTI647 dCas9-Mxi1 TetR KanMX was a gift from Nicholas Ingolia (Addgene plasmid # 139474 ; http://n2t.net/addgene:139474 ; RRID:Addgene_139474)
  • For your References section:

    A genome-scale CRISPR interference guide library enables comprehensive phenotypic profiling in yeast. McGlincy NJ, Meacham ZA, Reynaud KK, Muller R, Baum R, Ingolia NT. BMC Genomics. 2021 Mar 23;22(1):205. doi: 10.1186/s12864-021-07518-0. 10.1186/s12864-021-07518-0 PubMed 33757429