pNTI647 dCas9-Mxi1 TetR KanMX
(Plasmid #139474)

• Purpose: Integrates CRISPRi effector and tet-responsive regulator
• Depositing Lab: Nicholas Ingolia
• Publication: McGlincy et al BMC Genomics. 2021 Mar 23;22(1):205. doi: 10.1186/s12864-021-07518-0.

Backbone

• Vector backbone: pCfB2225
• Backbone manufacturer: Irina Borodina (Addgene plasmid # 67553)
• Backbone size w/o insert (bp): 6144
• Total vector size (bp): 12654
• Vector type: Yeast Expression, CRISPR
• Selectable markers: KanMX

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: dCas9-Mxi1
• Species: Synthetic; S pyogenes Cas9
• Insert Size (bp): 4344
• Mutation: D10A, H840A
• Promoter: pTEF1
• Tags / Fusion Proteins:
  • NLS (N terminal on insert)
  • NLS (C terminal on insert)
  • Mxi1 (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CTCTTTCGATGACCTCCCATTG
• 3′ sequencing primer: gtaatacgactcactataggg

Gene/Insert 2

• Gene/Insert name: Tet Repressor
• Alt name: TetR
• Species: Bacterial
• Insert Size (bp): 624
• Promoter: pGPM1

Cloning Information for Gene/Insert 2

• Cloning method: Gateway Cloning
• 5′ sequencing primer: gagtacaaacgcatgaaatcc
• 3′ sequencing primer: CGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAG

Resource Information

• Supplemental Documents:
  • pnti647-dcas9-tetr-kanmxsyn.gb
• A portion of this plasmid was derived from a plasmid made by: AddGene plasmids #73796 and #67553
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry