-
PurposeIntegrates CRISPRi effector and tet-responsive regulator
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 139474 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCfB2225
-
Backbone manufacturerIrina Borodina (Addgene plasmid # 67553)
- Backbone size w/o insert (bp) 6144
- Total vector size (bp) 12654
-
Vector typeYeast Expression, CRISPR
-
Selectable markersKanMX
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namedCas9-Mxi1
-
SpeciesSynthetic; S pyogenes Cas9
-
Insert Size (bp)4344
-
MutationD10A, H840A
- Promoter pTEF1
-
Tags
/ Fusion Proteins
- NLS (N terminal on insert)
- NLS (C terminal on insert)
- Mxi1 (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer CTCTTTCGATGACCTCCCATTG
- 3′ sequencing primer gtaatacgactcactataggg
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameTet Repressor
-
Alt nameTetR
-
SpeciesBacterial
-
Insert Size (bp)624
- Promoter pGPM1
Cloning Information for Gene/Insert 2
- Cloning method Gateway Cloning
- 5′ sequencing primer gagtacaaacgcatgaaatcc
- 3′ sequencing primer CGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byAddGene plasmids #73796 and #67553
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNTI647 dCas9-Mxi1 TetR KanMX was a gift from Nicholas Ingolia (Addgene plasmid # 139474 ; http://n2t.net/addgene:139474 ; RRID:Addgene_139474) -
For your References section:
A genome-scale CRISPR interference guide library enables comprehensive phenotypic profiling in yeast. McGlincy NJ, Meacham ZA, Reynaud KK, Muller R, Baum R, Ingolia NT. BMC Genomics. 2021 Mar 23;22(1):205. doi: 10.1186/s12864-021-07518-0. 10.1186/s12864-021-07518-0 PubMed 33757429