pNTI661 pRPR1(TetO)-sgRNA
(Plasmid #139475)

• Purpose: Vector for tet-regulated sgRNA expression in yeast
• Depositing Lab: Nicholas Ingolia
• Publication: McGlincy et al BMC Genomics. 2021 Mar 23;22(1):205. doi: 10.1186/s12864-021-07518-0.

Backbone

• Vector backbone: pRS41n
• Backbone size w/o insert (bp): 4898
• Total vector size (bp): 5171
• Vector type: Yeast Expression, CRISPR
• Selectable markers: LEU2

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: single guide RNA scaffold
• Alt name: sgRNA
• Species: Synthetic; S pyogenes
• Insert Size (bp): 82
• Promoter: pRPR1(TetO)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: cagcaacgcggcctttttacggttcctggcc
• 3′ sequencing primer: CAGGAAAGACCGCGGcttaaagtcatacattgcacgacta

Resource Information

• Supplemental Documents:
  • pnti661-sgrna-vector-leu.gb
  • sgRNA cloning
  • Barcode cloning
• A portion of this plasmid was derived from a plasmid made by: AddGene #73796
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry