Skip to main content

pTFUbiCre
(Plasmid #139670)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 139670 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pTF101
  • Backbone size w/o insert (bp) 9189
  • Total vector size (bp) 12635
  • Vector type
    Plant Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cre recombinase
  • Species
    bacteriophage p1
  • Insert Size (bp)
    1032
  • Promoter Maize Ubiquitin

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GATGCTCACCCTGTTGTTTGGTGT
  • 3′ sequencing primer AACGTGGGTAGCACCAAAAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Mutation A207T in Cre

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTFUbiCre was a gift from James Birchler (Addgene plasmid # 139670 ; http://n2t.net/addgene:139670 ; RRID:Addgene_139670)
  • For your References section:

    In vivo modification of a maize engineered minichromosome. Gaeta RT, Masonbrink RE, Zhao C, Sanyal A, Krishnaswamy L, Birchler JA. Chromosoma. 2013 Jun;122(3):221-32. doi: 10.1007/s00412-013-0403-3. Epub 2013 Mar 22. 10.1007/s00412-013-0403-3 PubMed 23519820