Skip to main content
Addgene
Open Menu

pSW071
(Plasmid #140037)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 140037 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 140037-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 140037-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pUC19
  • Total vector size (bp) 5266
  • Modifications to backbone
    Up and downstream sequences for homologous recombination into the PCC 11901 fadD locus
  • Vector type
    Gene knockout in cyanobacteria
  • Selectable markers
    Ampicillin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Kanamycin resistance gene
  • Alt name
    KanR
  • Species
    Synthetic; Escherichia coli
  • Insert Size (bp)
    810
  • Promoter KanR

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer agtaggattgtagccatgatttcgg
  • 3′ sequencing primer taggcacttggtttccgtccat
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    GenScript (pUC57-kan vector backbone)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/684944v1 for bioRxiv preprint.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSW071 was a gift from Peter Nixon (Addgene plasmid # 140037 ; http://n2t.net/addgene:140037 ; RRID:Addgene_140037)

  • For your References section:

    Newly discovered Synechococcus sp. PCC 11901 is a robust cyanobacterial strain for high biomass production. Wlodarczyk A, Selao TT, Norling B, Nixon PJ. Commun Biol. 2020 May 7;3(1):215. doi: 10.1038/s42003-020-0910-8. 10.1038/s42003-020-0910-8 PubMed 32382027
Related items:
Commonly requested with: