pSW071
(Plasmid #140037)

• Purpose: PCC 11901 fadD locus KO with a kanamycin resistance cassette
• Depositing Lab: Peter Nixon
• Publication: Unprecedented biomass and fatty acid production by the newly discovered cyanobacterium Synechococcus sp. PCC 11901 (unpublished)

Backbone

• Vector backbone: pUC19
  (Search Vector Database)
• Total vector size (bp): 5266
• Modifications to backbone: Up and downstream sequences for homologous recombination into the PCC 11901 fadD locus
• Vector type: Gene knockout in cyanobacteria
• Selectable markers: Ampicillin

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Kanamycin resistance gene
• Alt name: KanR
• Species: Synthetic; Escherichia coli
• Insert Size (bp): 810
• Promoter: KanR

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: agtaggattgtagccatgatttcgg
• 3′ sequencing primer: taggcacttggtttccgtccat

Resource Information

• Supplemental Documents:
  • psw071-puc-ssw07-faddkanr.gb
• A portion of this plasmid was derived from a plasmid made by: GenScript (pUC57-kan vector backbone)
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry