Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pSW036
(Plasmid #140034)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 140034 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pUC19
  • Total vector size (bp) 5144
  • Modifications to backbone
    Up and downstream homology regions for recombination into the acsA locus in PCC 11901; cpt promoter
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Yellow fluorescent protein
  • Alt name
    YFP
  • Species
    Synthetic; Aequorea victoria
  • Insert Size (bp)
    801
  • GenBank ID
    JX472996.1
  • Promoter cpt

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer aggtcatatccgaggcgtacattca
  • 3′ sequencing primer T7 terminator
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSW036 was a gift from Peter Nixon (Addgene plasmid # 140034 ; http://n2t.net/addgene:140034 ; RRID:Addgene_140034)