pSW039
(Plasmid
#140035)
-
PurposeKO of PCC 11901 psbA2 gene/expresses YFP under control of inducible cLac143 promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 140035 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC19
- Total vector size (bp) 7582
-
Modifications to backboneUp and downstream sequences for homologous recombination into PCC 11901 psbA2 locus; cLac143 inducible promoter and LacI gene under pMB2 promoter; Spectinomycin resistance cassette
-
Vector typeBacterial Expression
-
Selectable markersSpec
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameYellow fluorescent protein
-
Alt nameYFP
-
SpeciesSynthetic; Aequorea victoria
-
Insert Size (bp)795
-
GenBank IDJX472996.1
- Promoter cLac143
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ccccagtactttaaactggtacatgcaattgactcccctctggacatctcca
- 3′ sequencing primer T7 terminator
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byBrian Pfleger
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/684944v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSW039 was a gift from Peter Nixon (Addgene plasmid # 140035 ; http://n2t.net/addgene:140035 ; RRID:Addgene_140035) -
For your References section:
Newly discovered Synechococcus sp. PCC 11901 is a robust cyanobacterial strain for high biomass production. Wlodarczyk A, Selao TT, Norling B, Nixon PJ. Commun Biol. 2020 May 7;3(1):215. doi: 10.1038/s42003-020-0910-8. 10.1038/s42003-020-0910-8 PubMed 32382027