pSW039
(Plasmid #140035)

• Purpose: KO of PCC 11901 psbA2 gene/expresses YFP under control of inducible cLac143 promoter
• Depositing Lab: Peter Nixon
• Publication: Unprecedented biomass and fatty acid production by the newly discovered cyanobacterium Synechococcus sp. PCC 11901 (unpublished)

Backbone

• Vector backbone: pUC19
  (Search Vector Database)
• Total vector size (bp): 7582
• Modifications to backbone: Up and downstream sequences for homologous recombination into PCC 11901 psbA2 locus; cLac143 inducible promoter and LacI gene under pMB2 promoter; Spectinomycin resistance cassette
• Vector type: Bacterial Expression
• Selectable markers: Spec

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Yellow fluorescent protein
• Alt name: YFP
• Species: Synthetic; Aequorea victoria
• Insert Size (bp): 795
• GenBank ID: JX472996.1
• Promoter: cLac143

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ccccagtactttaaactggtacatgcaattgactcccctctggacatctcca
• 3′ sequencing primer: T7 terminator

Resource Information

• Supplemental Documents:
  • psw039-puc19-ssw07-psba2-clac143-yfp-.gb
• A portion of this plasmid was derived from a plasmid made by: Brian Pfleger

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Ancillary Agreement for Plasmids Containing FP Materials
• Industry Terms:
  • Not Available to Industry