Skip to main content

pET30a-His6-LOXCATmut
(Plasmid #140085)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 140085 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET30a
  • Backbone size w/o insert (bp) 8838
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    A fusion of lactate oxidase from A. viridans and catalase from E. coli
  • Species
    Lactate oxidase from A. viridans and Catalase from E. coli
  • Insert Size (bp)
    3600
  • Mutation
    Mutation in H265A and R268A in LOX (used original numbering for LOX)
  • Promoter T7
  • Tag / Fusion Protein
    • His6 (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (unknown if destroyed)
  • 3′ cloning site XhoI (unknown if destroyed)
  • 5′ sequencing primer TTGTGAGCGGATAACAATTCCCC
  • 3′ sequencing primer AAGGGGTTATGCTAGTTATTGCTCAG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Synthesized by Genscript Biotech

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET30a-His6-LOXCATmut was a gift from Vamsi Mootha (Addgene plasmid # 140085 ; http://n2t.net/addgene:140085 ; RRID:Addgene_140085)
  • For your References section:

    An engineered enzyme that targets circulating lactate to alleviate intracellular NADH:NAD(+) imbalance. Patgiri A, Skinner OS, Miyazaki Y, Schleifer G, Marutani E, Shah H, Sharma R, Goodman RP, To TL, Robert Bao X, Ichinose F, Zapol WM, Mootha VK. Nat Biotechnol. 2020 Jan 13. pii: 10.1038/s41587-019-0377-7. doi: 10.1038/s41587-019-0377-7. 10.1038/s41587-019-0377-7 PubMed 31932725