-
PurposeBackbone for cloning U6 driven LbCpf1 (Cas12a) crRNA, EF1a driven BFP + puromycin resistance
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 140086 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepHR
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin ; BFP fluorescence
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLbCpf1 (LbCas12a) crRNA backbone
-
SpeciesSynthetic
- Promoter U6
-
Tag
/ Fusion Protein
- EF1a-Puro-T2A-BFP (C terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cgggtttattacagggacagcagag
- 3′ sequencing primer gagccagtacacgacatcactttc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSLQ8453 pHR-hU6-LbCpf1 crRNA BB-EF1a-Puro-t2a-BFP-WPRE was a gift from Stanley Qi (Addgene plasmid # 140086 ; http://n2t.net/addgene:140086 ; RRID:Addgene_140086) -
For your References section:
Multiple Input Sensing and Signal Integration Using a Split Cas12a System. Kempton HR, Goudy LE, Love KS, Qi LS. Mol Cell. 2020 Jan 30. pii: S1097-2765(20)30037-X. doi: 10.1016/j.molcel.2020.01.016. 10.1016/j.molcel.2020.01.016 PubMed 32027839