pKM493
              
              
                (Plasmid
                
                #140191)
              
            
            
            
          - 
            PurposeORBIT integrating plasmid for C-terminal tagging with cleavable EGFP.
 - 
              Depositing Lab
 - 
          Sequence Information
 
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 140191 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepKM488
 - 
              Backbone manufacturerKenan Murphy
 - Backbone size w/o insert (bp) 3486
 - Total vector size (bp) 4247
 - 
              Modifications to backboneInsertion of TEV-Flag-Gly4-eGFP
 - 
              Vector typeBacterial Expression
 - 
                Selectable markersHygromycin
 
Growth in Bacteria
- 
            Bacterial Resistance(s)Chloramphenicol, 10 μg/mL
 - 
            Growth Temperature37°C
 - 
            Growth Strain(s)DH5alpha
 - 
            Copy numberLow Copy
 
Gene/Insert
- 
                Gene/Insert nameTEV-Flag-Gly4-eGFP
 - 
                    SpeciesSynthetic
 - 
                  Insert Size (bp)793
 - Promoter PGroEL
 - 
    
        Tag
        / Fusion Protein
    
- Flag + eGFP
 
 
Cloning Information
- Cloning method Restriction Enzyme
 - 5′ cloning site XhoI (not destroyed)
 - 3′ cloning site NotI (not destroyed)
 - 5′ sequencing primer GAGGAACTGGCGCAGTTCCTCTGG
 - 3′ sequencing primer CCTGGTATCTTTATAGTCCTGTCG (Common Sequencing Primers)
 
Terms and Licenses
- 
        Academic/Nonprofit Terms
 - 
      Industry Terms
- Not Available to Industry
 
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
 
Depositor Comments
pKM493 is an ORBIT integrating vector used to tag C-terminus of chromosomal genes with Flag-GFP.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              
For your Materials & Methods section:
pKM493 was a gift from Kenan Murphy (Addgene plasmid # 140191 ; http://n2t.net/addgene:140191 ; RRID:Addgene_140191) - 
                
For your References section:
ORBIT: a New Paradigm for Genetic Engineering of Mycobacterial Chromosomes. Murphy KC, Nelson SJ, Nambi S, Papavinasasundaram K, Baer CE, Sassetti CM. MBio. 2018 Dec 11;9(6). pii: mBio.01467-18. doi: 10.1128/mBio.01467-18. 10.1128/mBio.01467-18 PubMed 30538179