Skip to main content

pKM512
(Plasmid #140192)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 140192 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pKM461
  • Backbone manufacturer
    K. Murphy
  • Backbone size w/o insert (bp) 816
  • Total vector size (bp) 9906
  • Modifications to backbone
    Replaced RecT with gp47 Replaced kanamycin resistance gene with zeo resistance gene
  • Vector type
    Bacterial Expression
  • Selectable markers
    Zeocin ; Grow in LB containing 25 ug/mL zeocin.

Growth in Bacteria

  • Bacterial Resistance(s)
    Bleocin (Zeocin), 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    zeocin resistance gene
  • Insert Size (bp)
    597
  • Mutation
    Kanamycin resistance gene in pKM461 replaced with zeocin resistance gene by recombineering
  • Promoter EM7

Cloning Information for Gene/Insert 1

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CACAGGCCCGGTGTGAGAAGGGTC
  • 3′ sequencing primer CCGGTGAAGTCGTAGCATCGGTGA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Bxb1gp47 (directionality factor)
  • Species
    Mycobacterial phage Bxb1
  • Insert Size (bp)
    822
  • Mutation
    Cloned in gp47 directinality factor in place of RecT in pKM511 (a Zeo version of pKM461)
  • Promoter Ptet

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site KasI (not destroyed)
  • 5′ sequencing primer CACAGGCCCGGTGTGAGAAGGGTC
  • 3′ sequencing primer CCGGTGAAGTCGTAGCATCGGTGA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    gp47 gene was received from Graham Hatfull

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid can be used to removed ORBIT integrated plasmids leaving behind an Bxb1 attP site. After deletion of a target gene using ORBIT, the integrated plasmid (e.g., pKM464 - hygR) is excised by expressing phage Bxb1 Integrase and gp47 (directionality factor) from pKM512. A strain containing an ORBIT-generated deletion is transformed with pKM512 selecting for zeocin resistance. (This step cures the cell of pKM461 (kanR) used to make the deletion.) Select a zeoR colony containing pKM512 and grow to saturation in 7H10-zeocin. Dilute the culture 100-fold and regrow the strain in 7H10 without zeocin, but include 500 ng/ml anhydrotetracycline, (which induces expression of Integrase and gp47). Grow to saturation again, plate for single colonies, stab colonies on 7H10 plates containing 10% sucrose (Smeg) or 3% sucrose (Mtb) looking for hygromycin-sensitive colonies. Colonies should also be sensitive to kanamycin and zeocin. Once performed, the strain cannot be used for deletion of a second gene using ORBIT, as an attP site is now present at the site of the initial deletion.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKM512 was a gift from Kenan Murphy (Addgene plasmid # 140192 ; http://n2t.net/addgene:140192 ; RRID:Addgene_140192)
  • For your References section:

    ORBIT: a New Paradigm for Genetic Engineering of Mycobacterial Chromosomes. Murphy KC, Nelson SJ, Nambi S, Papavinasasundaram K, Baer CE, Sassetti CM. MBio. 2018 Dec 11;9(6). pii: mBio.01467-18. doi: 10.1128/mBio.01467-18. 10.1128/mBio.01467-18 PubMed 30538179