pCRI012-pGEM-PacI-PU3-BsmbI-NotI
              
              
                (Plasmid
                
                #140204)
              
            
            
            
          - 
            Purpose(Empty Backbone) Vector for cloning Cas9 sgRNA ( Step 1 of 2-step cloning). Contains AfU3 promoter driven sgRNA expression cassette flanked by PacI and NotI for further cloning in fungal vector.
- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 140204 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepGemT
- 
              Backbone manufacturerPromega
- Backbone size (bp) 3677
- 
              Modifications to backboneAf U3 promoter, BsmbI sites for spacers cloning, Cas9 sgRNA scaffold, Poly T terminator (x8)
- 
              Vector typeCRISPR, Synthetic Biology ; Step 1 of cloning Cas9 sgRNA for expression in Aspergillus nidulans.
- Promoter Aspergillus fumigatus U3 (RNAPIII).
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)DH5alpha
- 
            Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer M13-Rv ACAGGAAACAGCTATGACCATG (Common Sequencing Primers)
Resource Information
- 
            
            
            Supplemental Documents
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The expression cassette is flanked by PacI and NotI sites, for further cloning into a fungal vector.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pCRI012-pGEM-PacI-PU3-BsmbI-NotI was a gift from Yit Heng Chooi (Addgene plasmid # 140204 ; http://n2t.net/addgene:140204 ; RRID:Addgene_140204)
- 
                For your References section: CRISPR-mediated activation of biosynthetic gene clusters for bioactive molecule discovery in filamentous fungi. Roux I, Woodcraft C, Hu J, Wolters R, Gilchrist CLM, Chooi YH. ACS Synth Biol. 2020 Jun 11. doi: 10.1021/acssynbio.0c00197. 10.1021/acssynbio.0c00197 PubMed 32526136
 
    
 
    
 
                         
             
            