pSLQ8629 pHR-HREYBTATA-RR12EE345L-C term (406) dLbCpf1-2XNLS-miniVPR-mCherry-EFS-Puro-WPRE
(Plasmid
#140227)
-
PurposeHypoxia-inducible expression of leucine zipper with C terminal dCpf1 (Cas12a) 406-split half fused to miniVPR. Constitutive EFS-driven puromycin resistance.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 140227 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepHR
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namezipper with dLbCpf1 (Cas12a) C terminal half (406) fused to miniVPR
-
SpeciesSynthetic
- Promoter HRE (Hypoxia inducible)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cgggtttattacagggacagcagag (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSLQ8629 pHR-HREYBTATA-RR12EE345L-C term (406) dLbCpf1-2XNLS-miniVPR-mCherry-EFS-Puro-WPRE was a gift from Stanley Qi (Addgene plasmid # 140227 ; http://n2t.net/addgene:140227 ; RRID:Addgene_140227) -
For your References section:
Multiple Input Sensing and Signal Integration Using a Split Cas12a System. Kempton HR, Goudy LE, Love KS, Qi LS. Mol Cell. 2020 Jan 30. pii: S1097-2765(20)30037-X. doi: 10.1016/j.molcel.2020.01.016. 10.1016/j.molcel.2020.01.016 PubMed 32027839