-
PurposeExpresses guide RNA used to activate pGL3-Basic-8x-gRNA-eGFP reporter.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 60719 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepzDonor
- Backbone size w/o insert (bp) 3542
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegRNA (5'-AAAGGTCGAGAAACTGCAAA-3')
-
Insert Size (bp)20
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer TTTGCAGTTTTAAAATTATGT
- 3′ sequencing primer CAGGAAACAGCTATGACCATG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
gRNA-eGFP-Reporter was a gift from Charles Gersbach (Addgene plasmid # 60719 ; http://n2t.net/addgene:60719 ; RRID:Addgene_60719) -
For your References section:
A light-inducible CRISPR-Cas9 system for control of endogenous gene activation. Polstein LR, Gersbach CA. Nat Chem Biol. 2015 Feb 9. doi: 10.1038/nchembio.1753. 10.1038/nchembio.1753 PubMed 25664691