Skip to main content

Lenti-eCas9
(Plasmid #140237)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 140237 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    lentiCRISPR v2
  • Backbone manufacturer
    Feng Zhang lab
  • Backbone size (bp) 10017
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin
  • Tag / Fusion Protein
    • 3xFLAG (N terminal on insert)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    enhanced specificity Cas9 (1.1)
  • Alt name
    eSpCas9(1.1)
  • Species
    Synthetic
  • Insert Size (bp)
    4945
  • Promoter EF-1a core
  • Tag / Fusion Protein
    • 3xFLAG (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer gggggagaaccgtatataag
  • 3′ sequencing primer WPRE-R
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Lenti-eCas9 was a gift from Urs Greber (Addgene plasmid # 140237 ; http://n2t.net/addgene:140237 ; RRID:Addgene_140237)
  • For your References section:

    The E3 Ubiquitin Ligase Mind Bomb 1 Controls Adenovirus Genome Release at the Nuclear Pore Complex. Bauer M, Flatt JW, Seiler D, Cardel B, Emmenlauer M, Boucke K, Suomalainen M, Hemmi S, Greber UF. Cell Rep. 2019 Dec 17;29(12):3785-3795.e8. doi: 10.1016/j.celrep.2019.11.064. 10.1016/j.celrep.2019.11.064 PubMed 31851912