pCS2-CIB1-mCherry-Rab11
(Plasmid
#140573)
-
PurposeFor use in light-induced protein inactivation through the interaction with CRY2
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 140573 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCS2
- Backbone size w/o insert (bp) 4091
- Total vector size (bp) 5988
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameCIB1
-
Alt namecryptochrome-interacting basic-helix-loop-helix 1
-
SpeciesA. thaliana (mustard weed)
-
Insert Size (bp)1902
-
Entrez GeneCIB1 (a.k.a. AT4G34530, T4L20.110, T4L20_110, cryptochrome-interacting basic-helix-loop-helix 1)
- Promoter CMV IE94
-
Tag
/ Fusion Protein
- mCherry (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer SP6
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameRAB11A, member RAS oncogene family
-
SpeciesH. sapiens (human)
-
Insert Size (bp)648
-
Entrez GeneRAB11A (a.k.a. YL8)
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer ggcatggacgagctgtacaa
- 3′ sequencing primer T3
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byAddgene plasmid 58366
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCS2-CIB1-mCherry-Rab11 was a gift from Heidi Hehnly (Addgene plasmid # 140573 ; http://n2t.net/addgene:140573 ; RRID:Addgene_140573) -
For your References section:
Cytokinetic bridge triggers de novo lumen formation in vivo. Rathbun LI, Colicino EG, Manikas J, O'Connell J, Krishnan N, Reilly NS, Coyne S, Erdemci-Tandogan G, Garrastegui A, Freshour J, Santra P, Manning ML, Amack JD, Hehnly H. Nat Commun. 2020 Mar 9;11(1):1269. doi: 10.1038/s41467-020-15002-8. 10.1038/s41467-020-15002-8 PubMed 32152267