Skip to main content

pLX-TRE-dCas9-KRAB-MeCP2-BSD
(Plasmid #140690)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 140690 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    PB-TRE-dCas9-KRAB-MeCP2
  • Backbone manufacturer
    Andrea Califano
  • Total vector size (bp) 16734
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Cas9m4-KRAB-MeCP2
  • Species
    Synthetic

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCCCAAATTCTCGATTCACGC
  • 3′ sequencing primer CTCGGTGGGGTATCGACAGA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Chavez et al Nat Methods. 2015 Mar 2. doi: 10.1038/nmeth.3312
  • Articles Citing this Plasmid

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This is a lentiviral vector (modified in #122205; originally from Weissman lab #85969) with a Tet-ON 3G dCas9m4-KRAB-MeCP2 (Church lab; #63800). Note: the vector has been modified to use blasticidin selection.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLX-TRE-dCas9-KRAB-MeCP2-BSD was a gift from Andrea Califano (Addgene plasmid # 140690 ; http://n2t.net/addgene:140690 ; RRID:Addgene_140690)
  • For your References section:

    Interrogation of genome-wide, experimentally dissected gene regulatory networks reveals mechanisms underlying dynamic cellular state control. Tan X, Worley J, Turunen M, Wong K, Fernández EC, Paull E, Jones S, Wang J, Noh H, Salvatori B, Chavez A, Califano A. bioRxiv 2021.06.28.449297 10.1101/2021.06.28.449297