pMAK462
(Plasmid
#140700)
-
PurposeNBαMs/Rt-IgG1-Fc
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 140700 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMal-T-Avi-His/BirA
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNBαMs/Rt-IgG1-Fc
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer caatttcacacaggaaacagccag
- 3′ sequencing primer gtcctactcaggagagcgttc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMAK462 was a gift from Takayuki Iwaki (Addgene plasmid # 140700 ; http://n2t.net/addgene:140700 ; RRID:Addgene_140700) -
For your References section:
Nanobody production can be simplified by direct secretion from Escherichia coli. Iwaki T, Hara K, Umemura K. Protein Expr Purif. 2020 Feb 13;170:105607. doi: 10.1016/j.pep.2020.105607. 10.1016/j.pep.2020.105607 PubMed 32062022