-
PurposeFluorescent biosensor for 2GSH/GSSG ratio
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 141068 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCS2+
- Backbone size w/o insert (bp) 4072
- Total vector size (bp) 5149
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGrx1-roCherry
-
SpeciesSynthetic
-
Insert Size (bp)1077
-
MutationChanged Alanine 150 to Cysteine, inserted Threonine after Cysteine 150, changed Serine 151 to Glutamate, changed Lysine 203 to Cysteine
- Promoter CMV, SP6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site ClaI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer TCGGAGCAAGCTTGATTTAGGTGACACTATA
- 3′ sequencing primer GCATTCTAGTTGTGGTTTGTCCAAACTCATC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCS2+ Grx1-roCherry was a gift from Dmitry Bilan (Addgene plasmid # 141068 ; http://n2t.net/addgene:141068 ; RRID:Addgene_141068) -
For your References section:
Red fluorescent redox-sensitive biosensor Grx1-roCherry. Shokhina AG, Kostyuk AI, Ermakova YG, Panova AS, Staroverov DB, Egorov ES, Baranov MS, van Belle GJ, Katschinski DM, Belousov VV, Bilan DS. Redox Biol. 2019 Feb;21:101071. doi: 10.1016/j.redox.2018.101071. Epub 2018 Dec 7. 10.1016/j.redox.2018.101071 PubMed 30576927