pHLuc Control
(Plasmid
#141091)
-
PurposepH-stable bioluminescent reporter that serves as the control counterpart of pHLuc; utilizes eGFP instead of SEP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 141091 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCDNA3.1
-
Backbone manufacturerThermo Fisher Scientific
- Backbone size w/o insert (bp) 4606
- Total vector size (bp) 8980
-
Modifications to backboneNeomycin deleted
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameAntares-T2A-puromycin-IRESv24-eGFP-Nanoluc
-
Alt namepHLuc Control
-
Alt nameControl
-
SpeciesH. sapiens (human), M. musculus (mouse)
-
Insert Size (bp)4374
- Promoter CMV
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer T7 forward (TTAATACGACTCACTATAGGG)
- 3′ sequencing primer BGH reverse (TAGAAGGCACAGTCGAGG) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHLuc Control was a gift from Jeak Ling Ding (Addgene plasmid # 141091 ; http://n2t.net/addgene:141091 ; RRID:Addgene_141091) -
For your References section:
pHLuc, a Ratiometric Luminescent Reporter for in vivo Monitoring of Tumor Acidosis. Ong TT, Ang Z, Verma R, Koean R, Tam JKC, Ding JL. Front Bioeng Biotechnol. 2020 May 8;8:412. doi: 10.3389/fbioe.2020.00412. eCollection 2020. 10.3389/fbioe.2020.00412 PubMed 32457886