Skip to main content

ER-HA-mNG21-10
(Plasmid #141165)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 141165 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Ef1apHAGE-IRES-Blasticidin
  • Backbone size w/o insert (bp) 7400
  • Modifications to backbone
    Derived from pHAGE-shortEF1a-MCS-IRES-ZsGreen
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ER-HA-mNG21-10-KDEL
  • Species
    Synthetic
  • Insert Size (bp)
    763
  • Mutation
    K128M, S142T, R150M, G172V and K213M
  • Promoter Ef1a
  • Tag / Fusion Protein
    • Signal Sequence, KDEL and HA

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoR1 (not destroyed)
  • 3′ cloning site Xho1 (unknown if destroyed)
  • 5′ sequencing primer ATATAAGTGCAGTAGTCGCCG
  • 3′ sequencing primer ATATAGACAAACGCACACCG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    ER-HA-mNG21-10 was a gift from Wayne Lencer (Addgene plasmid # 141165 ; http://n2t.net/addgene:141165 ; RRID:Addgene_141165)
  • For your References section:

    A quantitative single-cell assay for retrograde membrane traffic enables rapid detection of defects in cellular organization. Luong P, Li Q, Chen PF, Wrighton PJ, Chang D, Dwyer S, Bayer MT, Snapper SB, Hansen SH, Thiagarajah JT, Goessling W, Lencer WI. Mol Biol Cell. 2019 Nov 27:mbcE19070375. doi: 10.1091/mbc.E19-07-0375. 10.1091/mbc.E19-07-0375 PubMed 31774722