pAAV-Ef1a-FAS-NES-jRGECO1a-WPRE
(Plasmid #141236)

• Purpose: AAV vector with Ef1a promoter and LoxFAS sites for Cre-Off expression of jRGECO1a (jRGECO1a will not be expressed in mammalian cells that express Cre recombinase)
• Depositing Lab: Guohong Cui
• Publication: Meng et al Neuron. 2018 May 16;98(4):707-717.e4. doi: 10.1016/j.neuron.2018.04.012. Epub 2018 May 3.

Backbone

• Vector backbone: pAAV-Ef1a-FAS-insert-WPRE-pA
• Backbone manufacturer: B. Sabatini Lab
• Backbone size w/o insert (bp): 5142
• Total vector size (bp): 6843
• Vector type: AAV, Cre/Lox ; Cre-Off

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: NES-jRGECO1a
• Alt name: NES-R-GECO1.0 variant 1670
• Insert Size (bp): 1413
• Promoter: human elongation factor-1 alpha (EF-1 alpha)
• Tags / Fusion Proteins:
  • nuclear export signal (N terminal on insert)
  • 6xHIS tag (N terminal on insert)

Cloning Information

• Cloning method: Other
• 5′ sequencing primer: Ef1a-F, tcaagcctcagacagtggttc
• 3′ sequencing primer: WPRE-R, gcagcgtatccacatag

Resource Information

• Supplemental Documents:
  • pAAV-Ef1a-FAS-NES-jRGECO1a-WPRE-pA.gb
• A portion of this plasmid was derived from a plasmid made by: NES-jRGECO1a was a gift from Douglas Kim & GENIE Project, Addgene 61563.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Sensitive red protein calcium indicators for imaging neural activity. Dana H, Mohar B, Sun Y, Narayan S, Gordus A, Hasseman JP, Tsegaye G, Holt GT, Hu A, Walpita D, Patel R, Macklin JJ, Bargmann CI, Ahrens MB, Schreiter ER, Jayaraman V, Looger LL, Svoboda K, Kim DS. Elife. 2016 Mar 24;5. pii: e12727. doi: 10.7554/eLife.12727.