pAAV-Ef1a-FAS-NES-jRGECO1a-WPRE
(Plasmid
#141236)
-
PurposeAAV vector with Ef1a promoter and LoxFAS sites for Cre-Off expression of jRGECO1a (jRGECO1a will not be expressed in mammalian cells that express Cre recombinase)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 141236 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV-Ef1a-FAS-insert-WPRE-pA
-
Backbone manufacturerB. Sabatini Lab
- Backbone size w/o insert (bp) 5142
- Total vector size (bp) 6843
-
Vector typeAAV, Cre/Lox ; Cre-Off
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNES-jRGECO1a
-
Alt nameNES-R-GECO1.0 variant 1670
-
Insert Size (bp)1413
- Promoter human elongation factor-1 alpha (EF-1 alpha)
-
Tags
/ Fusion Proteins
- nuclear export signal (N terminal on insert)
- 6xHIS tag (N terminal on insert)
Cloning Information
- Cloning method Other
- 5′ sequencing primer Ef1a-F, tcaagcctcagacagtggttc
- 3′ sequencing primer WPRE-R, gcagcgtatccacatag (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byNES-jRGECO1a was a gift from Douglas Kim & GENIE Project, Addgene 61563.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Sensitive red protein calcium indicators for imaging neural activity. Dana H, Mohar B, Sun Y, Narayan S, Gordus A, Hasseman JP, Tsegaye G, Holt GT, Hu A, Walpita D, Patel R, Macklin JJ, Bargmann CI, Ahrens MB, Schreiter ER, Jayaraman V, Looger LL, Svoboda K, Kim DS. Elife. 2016 Mar 24;5. pii: e12727. doi: 10.7554/eLife.12727.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-Ef1a-FAS-NES-jRGECO1a-WPRE was a gift from Guohong Cui (Addgene plasmid # 141236 ; http://n2t.net/addgene:141236 ; RRID:Addgene_141236) -
For your References section:
Spectrally Resolved Fiber Photometry for Multi-component Analysis of Brain Circuits. Meng C, Zhou J, Papaneri A, Peddada T, Xu K, Cui G. Neuron. 2018 May 16;98(4):707-717.e4. doi: 10.1016/j.neuron.2018.04.012. Epub 2018 May 3. 10.1016/j.neuron.2018.04.012 PubMed 29731250