-
PurposePlasmid for curing pMUT2 in one step based on pFREE. Contains RelB antitoxin, as well as gRNA targetting pMUT2 plasmid as well as pCryptDel4.8 itself.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 141293 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepFREE
-
Backbone manufacturerLauritsen et al. Microb. Cell Factories 16, (2017).
- Total vector size (bp) 7621
-
Vector typeBacterial Expression, CRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameRelB
-
SpeciesEscherichia coli Nissle 1917
-
Insert Size (bp)142
-
GenBank IDWP_001554710
- Promoter Native promoter from pMUT2 relB/relE operon
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer CTGAAACCTCAGGCATTTGAGAAGC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namegRNA targetting pMUT2
-
SpeciesSynthetic
-
Insert Size (bp)30
- Promoter Prha (rhamnose inducible promoter)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer cccagtcagctccttccgg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCryptDel4.8 was a gift from Neel Joshi (Addgene plasmid # 141293 ; http://n2t.net/addgene:141293 ; RRID:Addgene_141293) -
For your References section:
Plasmid Vectors for in Vivo Selection-Free Use with the Probiotic E. coli Nissle 1917. Kan A, Gelfat I, Emani S, Praveschotinunt P, Joshi NS. ACS Synth Biol. 2020 Dec 10. doi: 10.1021/acssynbio.0c00466. 10.1021/acssynbio.0c00466 PubMed 33301298