pCAG-scFvGCN4sfGFP-VP64-GB1
(Plasmid
#141417)
-
PurposeExpress scFvGCN4-sfGFP-VP64 fusion protein for dCas9-SunTag mediated targeted gene activation
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 141417 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCAG
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namescFvGCN4sfGFP-VP64-GB1
-
Insert Size (bp)2031
-
GenBank IDLC169511
- Promoter CAG
-
Tags
/ Fusion Proteins
- sfGFP
- HA
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CGGCTTCTGGCGTGTGACC
- 3′ sequencing primer caaaccacaactagaatgcag
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-scFvGCN4sfGFP-VP64-GB1 was a gift from Izuho Hatada (Addgene plasmid # 141417 ; http://n2t.net/addgene:141417 ; RRID:Addgene_141417) -
For your References section:
Synergistic Upregulation of Target Genes by TET1 and VP64 in the dCas9-SunTag Platform. Morita S, Horii T, Kimura M, Hatada I. Int J Mol Sci. 2020 Feb 25;21(5). pii: ijms21051574. doi: 10.3390/ijms21051574. 10.3390/ijms21051574 PubMed 32106616