Skip to main content

pCXLE-hSK-CD
(Plasmid #145379)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 145379 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pCXLE-gw
  • Backbone size w/o insert (bp) 10184
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    scFCY1, SOX2, KLF4
  • Species
    H. sapiens (human), S. cerevisiae (budding yeast)
  • Insert Size (bp)
    2493
  • Entrez Gene
    SOX2 (a.k.a. ANOP3, MCOPS3)
  • Entrez Gene
    KLF4 (a.k.a. EZF, GKLF)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer GCAACGTGCTGGTTATTGTG
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCXLE-hSK-CD was a gift from Janghwan Kim (Addgene plasmid # 145379)
  • For your References section:

    Efficient exogenous DNA-free reprogramming with suicide gene vectors. Lee M, Ha J, Son YS, Ahn H, Jung KB, Son MY, Kim J. Exp Mol Med. 2019 Jul 19;51(7):82. doi: 10.1038/s12276-019-0282-7. 10.1038/s12276-019-0282-7 PubMed 31324753