pCXLE-hSK-CD
(Plasmid
#145379)
-
PurposeEpisomal reprogramming vector for delivery of SOX2 and KLF4 to generate EF-iPSCs. Contains scFCY1 gene for CD/5-FC counterselection.
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 145379 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepCXLE-gw
- Backbone size w/o insert (bp) 10184
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer GCAACGTGCTGGTTATTGTG
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCXLE-hSK-CD was a gift from Janghwan Kim (Addgene plasmid # 145379) -
For your References section:
Efficient exogenous DNA-free reprogramming with suicide gene vectors. Lee M, Ha J, Son YS, Ahn H, Jung KB, Son MY, Kim J. Exp Mol Med. 2019 Jul 19;51(7):82. doi: 10.1038/s12276-019-0282-7. 10.1038/s12276-019-0282-7 PubMed 31324753