Skip to main content

pYL156 (TRV RNA2)
(Plasmid #148969)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 148969 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCAMBIA0390 T-DNA vector
  • Backbone size w/o insert (bp) 6426
  • Total vector size (bp) 9663
  • Vector type
    T-DNA vector
  • Selectable markers
    Kanamycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    We prefer to use DH10B cells
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Modified TRV RNA2
  • Species
    Modified Tobacco Rattle Virus RNA 2
  • Insert Size (bp)
    2106
  • Mutation
    see comments section below
  • GenBank ID
    AF406991

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI, XbaI, StuI, NcoI, BamHI, KpnI, SacI, MluI, XhoI, XmaI (unknown if destroyed)
  • 3′ cloning site None (unknown if destroyed)
  • 5′ sequencing primer TGTTACTCAAGGAAGCACGATGAGCT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

There are a few differences between the Addgene full sequence and the Genbank ID: AF406991. These discrepancies were confirmed to not cause functional differences:
- 1 bp insertion (T3313) in backbone.
- 1 bp mismatch (T5593C) and 1 bp insertion (G5646) in pVS1 RepA (known variant).
- IS4-like element inserted between ori and KanR (1338bp insert at positions 8295-9632bp).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pYL156 (TRV RNA2) was a gift from Savithramma Dinesh-Kumar (Addgene plasmid # 148969 ; http://n2t.net/addgene:148969 ; RRID:Addgene_148969)
  • For your References section:

    Tobacco Rar1, EDS1 and NPR1/NIM1 like genes are required for N-mediated resistance to tobacco mosaic virus. Liu Y, Schiff M, Marathe R, Dinesh-Kumar SP. Plant J. 2002 May;30(4):415-29. doi: 10.1046/j.1365-313x.2002.01297.x. 10.1046/j.1365-313x.2002.01297.x PubMed 12028572