-
PurposeModified Tobacco Rattle Virus RNA 2; used for virus induced gene silencing in plants along with pYL192 (TRV RNA1)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 148969 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCAMBIA0390 T-DNA vector
- Backbone size w/o insert (bp) 6426
- Total vector size (bp) 9663
-
Vector typeT-DNA vector
-
Selectable markersKanamycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsWe prefer to use DH10B cells
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameModified TRV RNA2
-
SpeciesModified Tobacco Rattle Virus RNA 2
-
Insert Size (bp)2106
-
Mutationsee comments section below
-
GenBank IDAF406991
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI, XbaI, StuI, NcoI, BamHI, KpnI, SacI, MluI, XhoI, XmaI (unknown if destroyed)
- 3′ cloning site None (unknown if destroyed)
- 5′ sequencing primer TGTTACTCAAGGAAGCACGATGAGCT
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
There are a few differences between the Addgene full sequence and the Genbank ID: AF406991. These discrepancies were confirmed to not cause functional differences:
- 1 bp insertion (T3313) in backbone.
- 1 bp mismatch (T5593C) and 1 bp insertion (G5646) in pVS1 RepA (known variant).
- IS4-like element inserted between ori and KanR (1338bp insert at positions 8295-9632bp).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pYL156 (TRV RNA2) was a gift from Savithramma Dinesh-Kumar (Addgene plasmid # 148969 ; http://n2t.net/addgene:148969 ; RRID:Addgene_148969) -
For your References section:
Tobacco Rar1, EDS1 and NPR1/NIM1 like genes are required for N-mediated resistance to tobacco mosaic virus. Liu Y, Schiff M, Marathe R, Dinesh-Kumar SP. Plant J. 2002 May;30(4):415-29. doi: 10.1046/j.1365-313x.2002.01297.x. 10.1046/j.1365-313x.2002.01297.x PubMed 12028572