-
PurposeModified Tobacco rattle virus RNA2 vector that could be used for expression of sgRNAs
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 149276 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCAMBIA0390 T-DNA vector
- Backbone size w/o insert (bp) 6426
- Total vector size (bp) 9651
-
Vector typeT-DNA vector
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsWe prefer to use DH10B
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameModified TRV RNA2 with PEBV promoter and AtIleu-tRNA mobile RNA sequence
-
SpeciesModified TRV RNA2 with PEBV promoter and AtIleu-tRNA mobile RNA sequence
-
Insert Size (bp)2094
-
MutationT2318C (DNA) in PEBV coat protein sequence
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI, StuI, BamHI, KpnI, SacI (not destroyed)
- 3′ cloning site None (unknown if destroyed)
- 5′ sequencing primer CATAATTATACTGATTTGTCTCTCG
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
SPDK3888(TRV-RNA2-pPEBV-MCS-AtIleu-tRNA) was a gift from Savithramma Dinesh-Kumar (Addgene plasmid # 149276 ; http://n2t.net/addgene:149276 ; RRID:Addgene_149276) -
For your References section:
Multiplexed heritable gene editing using RNA viruses and mobile single guide RNAs. Ellison EE, Nagalakshmi U, Gamo ME, Huang PJ, Dinesh-Kumar S, Voytas DF. Nat Plants. 2020 Jun 1. pii: 10.1038/s41477-020-0670-y. doi: 10.1038/s41477-020-0670-y. 10.1038/s41477-020-0670-y PubMed 32483329