Skip to main content
Addgene

SPDK3888(TRV-RNA2-pPEBV-MCS-AtIleu-tRNA)
(Plasmid #149276)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 149276 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCAMBIA0390 T-DNA vector
  • Backbone size w/o insert (bp) 6426
  • Total vector size (bp) 9651
  • Vector type
    T-DNA vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    We prefer to use DH10B
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Modified TRV RNA2 with PEBV promoter and AtIleu-tRNA mobile RNA sequence
  • Species
    Modified TRV RNA2 with PEBV promoter and AtIleu-tRNA mobile RNA sequence
  • Insert Size (bp)
    2094
  • Mutation
    T2318C (DNA) in PEBV coat protein sequence

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI, StuI, BamHI, KpnI, SacI (not destroyed)
  • 3′ cloning site None (unknown if destroyed)
  • 5′ sequencing primer CATAATTATACTGATTTGTCTCTCG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    SPDK3888(TRV-RNA2-pPEBV-MCS-AtIleu-tRNA) was a gift from Savithramma Dinesh-Kumar (Addgene plasmid # 149276 ; http://n2t.net/addgene:149276 ; RRID:Addgene_149276)
  • For your References section:

    Multiplexed heritable gene editing using RNA viruses and mobile single guide RNAs. Ellison EE, Nagalakshmi U, Gamo ME, Huang PJ, Dinesh-Kumar S, Voytas DF. Nat Plants. 2020 Jun 1. pii: 10.1038/s41477-020-0670-y. doi: 10.1038/s41477-020-0670-y. 10.1038/s41477-020-0670-y PubMed 32483329