pcDNA3.4_CEACAM6-His
(Plasmid
#149337)
-
Purposefor eukaryotic expression and purification of CEACAM6-His6
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 149337 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.4_mIgG2-mMxr8a
-
Backbone manufacturerDiamond lab
- Backbone size w/o insert (bp) 7472
- Total vector size (bp) 6320
-
Modifications to backboneoriginal plasmid digested with EcoRI/AgeI to remove portion of prior insert leaving IL-2 signal peptide sequence and C-terminal polyhistidine tag.
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCEACAM6
-
SpeciesH. sapiens (human)
-
Insert Size (bp)858
-
Mutationpoint mutation (GGA to GCA) to replace 'G-glycine' with 'A-alanine' at the site of lipidation required for GPI anchoring at plasmid position 1772
-
Entrez GeneCEACAM6 (a.k.a. CD66c, CEAL, NCA)
- Promoter CMV
-
Tags
/ Fusion Proteins
- polyhistidine (C terminal on insert)
- IL-2 signal peptide (N terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAAGTCTTGCACTTGTCACGAATTCGATATCGAAGCTCACTATTGAATCCACG
- 3′ sequencing primer CTCAATGGTGATGGTGATGATGACCGGTTGCAGAGACTGTGATCATCGTG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byoriginal CEACAM6 clone was obtained from pRC202454 OriGene
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.4_CEACAM6-His was a gift from James Fleckenstein (Addgene plasmid # 149337 ; http://n2t.net/addgene:149337 ; RRID:Addgene_149337) -
For your References section:
CEACAMs serve as toxin-stimulated receptors for enterotoxigenic Escherichia coli. Sheikh A, Tumala B, Vickers TJ, Alvarado D, Ciorba MA, Bhuiyan TR, Qadri F, Singer BB, Fleckenstein JM. Proc Natl Acad Sci U S A. 2020 Nov 17;117(46):29055-29062. doi: 10.1073/pnas.2012480117. Epub 2020 Nov 2. 10.1073/pnas.2012480117 PubMed 33139570