pME18S-F-R-hb2AR
(Plasmid
#149367)
-
PurposeExpresses human b2AR in mammalian cells.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 149367 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepME18S
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameb2AR
-
SpeciesH. sapiens (human)
-
Entrez GeneADRB2 (a.k.a. ADRB2R, ADRBR, ARB2, B2AR, BAR, BETA2AR)
- Promoter SR alpha
-
Tags
/ Fusion Proteins
- FLAG (N terminal on backbone)
- rhodopsin (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site SacII (not destroyed)
- 5′ sequencing primer GGCCTGTACGGAAGTGTTAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pME18S-F-R-hb2AR was a gift from Takeshi Imai (Addgene plasmid # 149367 ; http://n2t.net/addgene:149367 ; RRID:Addgene_149367) -
For your References section:
Widespread Inhibition, Antagonism, and Synergy in Mouse Olfactory Sensory Neurons In Vivo. Inagaki S, Iwata R, Iwamoto M, Imai T. Cell Rep. 2020 Jun 30;31(13):107814. doi: 10.1016/j.celrep.2020.107814. 10.1016/j.celrep.2020.107814 PubMed 32610120