pROSA26-FlpERT2
(Plasmid
#149438)
-
PurposeROSA26 mouse targeting vector with tamoxifen-inducible Flp recombinase
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 149438 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepROSA26-TG
-
Backbone manufacturerLiqun Luo Lab (Addgene Plasmid #40026)
- Backbone size w/o insert (bp) 14486
- Total vector size (bp) 15505
-
Vector typeMammalian Expression, Mouse Targeting, Cre/Lox
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFlp-ERT2 fusion protein
-
Alt nameinducible Flp recombinase
-
SpeciesSynthetic
-
Insert Size (bp)3968
- Promoter CAG promoter
-
Tag
/ Fusion Protein
- ERT2 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PacI (not destroyed)
- 3′ cloning site AscI (not destroyed)
- 5′ sequencing primer pCAG-F
- 3′ sequencing primer ACGCCCACACACCAGGTTAG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byConnie Cepko Lab: pCAG-FlpeERT2 (Addgene Plasmid #14756)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pROSA26-FlpERT2 was a gift from Primo Schaer (Addgene plasmid # 149438 ; http://n2t.net/addgene:149438 ; RRID:Addgene_149438) -
For your References section:
Inducible TDG knockout models to study epigenetic regulation. Schwarz SD, Grundbacher E, Hrovat AM, Xu J, Kusnierczyk A, Vagbo CB, Schar P, Schuermann D. F1000Res. 2020 Sep 9;9:1112. doi: 10.12688/f1000research.25637.2. eCollection 2020. 10.12688/f1000research.25637.2 PubMed 33082936