-
Purpose(Empty Backbone) Expression of single pegRNA under control of Drosophila U6:3 promoter. NS stands for "No Scaffold". Can be used to generate transgenic flies with vermillion+ selection.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 149545 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCFD3
-
Backbone manufacturerFillip Port
-
Modifications to backbonepCFD3 was digested with BbsI/XbaI. A new insert (BbsI/BbsI) added by Gibson cloning a gBlock fragment.
-
Vector typeInsect Expression, CRISPR
- Promoter U6
-
Selectable markersvermillion+
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer acgttttataacttatgcccctaag
- 3′ sequencing primer gccgagcacaattgtctagaatgc
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCFD3-NS was a gift from Norbert Perrimon (Addgene plasmid # 149545 ; http://n2t.net/addgene:149545 ; RRID:Addgene_149545) -
For your References section:
Precise genome engineering in Drosophila using prime editing. Bosch JA, Birchak G, Perrimon N. Proc Natl Acad Sci U S A. 2021 Jan 5;118(1). pii: 2021996118. doi: 10.1073/pnas.2021996118. 10.1073/pnas.2021996118 PubMed 33443210