Skip to main content

pCFD5-NS
(Plasmid #149546)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 149546 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCFD5
  • Backbone manufacturer
    Fillip Port
  • Modifications to backbone
    pCFD5 was digested with BbsI/XbaI. A new insert containing BbsI/BbsI was added by Gibson cloning a gBlock fragment.
  • Vector type
    Insect Expression, CRISPR
  • Promoter U6
  • Selectable markers
    vermillion+

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer acgttttataacttatgcccctaag
  • 3′ sequencing primer gccgagcacaattgtctagaatgc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCFD5-NS was a gift from Norbert Perrimon (Addgene plasmid # 149546 ; http://n2t.net/addgene:149546 ; RRID:Addgene_149546)
  • For your References section:

    Precise genome engineering in Drosophila using prime editing. Bosch JA, Birchak G, Perrimon N. Proc Natl Acad Sci U S A. 2021 Jan 5;118(1). pii: 2021996118. doi: 10.1073/pnas.2021996118. 10.1073/pnas.2021996118 PubMed 33443210