pCFD6-NS
(Plasmid
#149547)
-
PurposeExpression of pegRNA(s) and sgRNA(s) under control of UAS promoter. NS stands for "No Scaffold". Can be used to generate transgenic flies with vermillion+ selection.
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 149547 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCFD6
-
Backbone manufacturerFillip Port
-
Modifications to backbonepCFD6 was digested with EcoRI/XbaI. A new insert (BbsI/BbsI) added by Gibson cloning a gBlock fragment.
-
Vector typeInsect Expression, CRISPR
-
Selectable markersvermillion+
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDm gly tRNA, BbsI/BbsI, Os gly tRNA
-
SpeciesSynthetic
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GAATGAATGTTCGAGCCGAGC
- 3′ sequencing primer ttagagctttaaatctctgtaggtag (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCFD6-NS was a gift from Norbert Perrimon (Addgene plasmid # 149547)
