pUAS-PE2-attB
(Plasmid
#149550)
-
PurposeExpression of PE2 enzyme under control of the Gal4-regulated UAS promoter. Can be used to generate transgenic flies with white+ selection.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 149550 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepWALIUM10-roe
-
Backbone manufacturerDrosophila Genomics Resource Center
-
Modifications to backbonePE2 added by Gateway Cloning LR reaction.
-
Vector typeInsect Expression, CRISPR
-
Selectable markersmini-white+
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePE2
-
Alt namePrime editor 2
-
SpeciesSynthetic
-
Insert Size (bp)6354
- Promoter UAS
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer accagcaaccaagtaaatcaac
- 3′ sequencing primer TAATCGTGTGTGATGCCTACC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byPE2 coding sequence PCR amplified from pCMV-PE2 (Addgene 132775). David Liu lab.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUAS-PE2-attB was a gift from Norbert Perrimon (Addgene plasmid # 149550 ; http://n2t.net/addgene:149550 ; RRID:Addgene_149550) -
For your References section:
Precise genome engineering in Drosophila using prime editing. Bosch JA, Birchak G, Perrimon N. Proc Natl Acad Sci U S A. 2021 Jan 5;118(1). pii: 2021996118. doi: 10.1073/pnas.2021996118. 10.1073/pnas.2021996118 PubMed 33443210