pSCALPS_miR-146aSponge_mCherry_GFP
(Plasmid
#149718)
-
PurposeLentiviral vector expressing a miR-146a decoy sponge
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 149718 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepSCALPS_mCherry_GFP
- Backbone size w/o insert (bp) 8518
- Total vector size (bp) 8929
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name14X miR-146a binding sites
-
SpeciesSynthetic
-
Insert Size (bp)411
-
MutationG to T mutation in position 75 of the insert
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CCCCGTAATGCAGAAGAAGA
- 3′ sequencing primer GTTGTCAAGCGATGAGGCGCGT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSCALPS_miR-146aSponge_mCherry_GFP was a gift from Silvia Monticelli (Addgene plasmid # 149718 ; http://n2t.net/addgene:149718 ; RRID:Addgene_149718) -
For your References section:
A molecular network regulating the proinflammatory phenotype of human memory T lymphocytes. Emming S, Bianchi N, Polletti S, Balestrieri C, Leoni C, Montagner S, Chirichella M, Delaleu N, Natoli G, Monticelli S. Nat Immunol. 2020 Apr;21(4):388-399. doi: 10.1038/s41590-020-0622-8. Epub 2020 Mar 16. 10.1038/s41590-020-0622-8 PubMed 32205878