-
Purpose(Empty Backbone) Expresses proteins in the periplasm as fusions to a high-binding mutant (A313V) maltose-binding protein
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 150814 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * |
* Log in to view industry pricing.
Backbone
-
Vector backbonepMAL-p5X
-
Backbone manufacturerNew England Biolabs
- Backbone size (bp) 5752
-
Vector typeBacterial Expression
- Promoter tac
-
Tag
/ Fusion Protein
- malE A313V (N terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer GGTCGTCAGACTGTCGATGAAGCC
- 3′ sequencing primer TGTCCTACTCAGGAGAGCGTTCAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Any E. coli strain can be used for expression of fusion proteins; NEBExpress, BL21, or BL21(DE3) are good first choices; Commercial use requires a license from New England Biolabs.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMAL-p5X was a gift from Paul Riggs (Addgene plasmid # 150814 ; http://n2t.net/addgene:150814 ; RRID:Addgene_150814)