Skip to main content

pMAL-p5X
(Plasmid #150814)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 150814 Standard format: Plasmid sent in bacteria as agar stab 1 $89 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pMAL-p5X
  • Backbone manufacturer
    New England Biolabs
  • Backbone size (bp) 5752
  • Vector type
    Bacterial Expression
  • Promoter tac
  • Tag / Fusion Protein
    • malE A313V (N terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer GGTCGTCAGACTGTCGATGAAGCC
  • 3′ sequencing primer TGTCCTACTCAGGAGAGCGTTCAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Any E. coli strain can be used for expression of fusion proteins; NEBExpress, BL21, or BL21(DE3) are good first choices; Commercial use requires a license from New England Biolabs.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMAL-p5X was a gift from Paul Riggs (Addgene plasmid # 150814 ; http://n2t.net/addgene:150814 ; RRID:Addgene_150814)